Journal: The EMBO Journal

Article Title: Resistance to CDK7 inhibitors directed by acquired mutation of a conserved residue in cancer cells

doi: 10.1038/s44318-025-00554-6

Figure Lengend Snippet: ( A ) Alignment of human CDKs demonstrates absolute conservation of Asp97 in human CDKs. ( B ) Sequencing chromatograms of gDNA prepared from MCF7-WT. Also shown are the gDNA sequences for (i) MCF7 cells, (ii) MCF7 following CRISPR-Cas9 mutagenesis and (iii) for gDNA prepared from cells after culturing for 4 weeks in the presence of 400 nM (R)-CR8. The positions of the silent changes, as well as the mutations in the codon encoding CDK12-D819, are shown, the mixed sequences at these positions being indicative of heterozygosity. ( C ) Growth assays were performed using 2× serial dilutions of the drugs. Error bars represent the standard errors of the mean (SEM) for n = 2 (THZ531) and n = 3 ((R)-CR8) independent experiments for MCF7 CDK12-WT and CDK12-D819N mutant cells. Each experiment contains measurements for six internal replicates. ( D ) Mean IC 50 values determined from the results in ( C ). ( E ) Immunoblotting of protein lysates from cells treated with (R)-CR8 or THZ531 for 6 h. An equal volume of DMSO was added to the vehicle controls. .

Article Snippet: Immunoblotting was performed as described (Patel et al, ), using antibodies diluted 1:1000 for P-CDK2 (Thr160; 2561S), CDK2 (2546S), P-Rb (Ser807/811; 9308), Rb (9309), CDK7 (2916) and CDK12 (11973S), from Cell Signalling Technology.

Techniques: Sequencing, CRISPR, Mutagenesis, Western Blot

Journal: The EMBO Journal

Article Title: Resistance to CDK7 inhibitors directed by acquired mutation of a conserved residue in cancer cells

doi: 10.1038/s44318-025-00554-6

Figure Lengend Snippet: ( A ) Strategy for generating the D819N mutation in the CDK12 gene. The full sequence of the donor template is: 5’-TTCGTCTTTATGTAGGTGCCTTTTACCTTGTATTTGAGTACATGGATCACAATCTTATGGGACTGCTAGAATCTGGTTTGGTGCACTTTTCTGAGGACCA-3’. ( B ) PCR was carried out using gDNA and primers amplifying the region around exon 6 (“locus PCR”; 5’-CGCCCAGCCACAGAAGATTA-3’ and 5’-GAGGAGAAGAGGAAAGTGCTTAA-3’, product size: 458 bp). PCR using primers, one of which is located within the region containing base changes incorporated in the donor template (“mutant PCR”; 5’-GGACTTGAGGCATTGTTATTT-3’ and 5’-CCATAAGATTGTGATCCATG-3’, product size: 116 bp), was carried out with gDNA prepared from cells following RNP CRISPR knock-in but prior to selection with (R)-CR8.

Article Snippet: Immunoblotting was performed as described (Patel et al, ), using antibodies diluted 1:1000 for P-CDK2 (Thr160; 2561S), CDK2 (2546S), P-Rb (Ser807/811; 9308), Rb (9309), CDK7 (2916) and CDK12 (11973S), from Cell Signalling Technology.

Techniques: Mutagenesis, Sequencing, CRISPR, Knock-In, Selection

Journal: Frontiers in Oncology

Article Title: Low Expression of SLC7A11 Confers Drug Resistance and Worse Survival in Ovarian Cancer via Inhibition of Cell Autophagy as a Competing Endogenous RNA

doi: 10.3389/fonc.2021.744940

Figure Lengend Snippet: Kaplan–Meier analysis of gene expression with OC survival in a large sample of 1815 OC patients using the Kaplan–Meier Plotter tool. The auto-selected best cutoff value was used to dichotomize gene expression into high (H) and low (L). (A) Low expression of OPA1, VCP and SLC7A11 predicted poor OS, PFS and PPS; (B) As ceRNA target of SLC7A11, STX17 and UVRAG suppression predicted poor OS, PFS and/or PPS; (C) The combination of SLC7A11 expression with STX17 or UVRAG was associated with poor OS, PFS and/or PPS. OS, overall survival; PFS, progression-free survival; PPS, post-progression survival.

Article Snippet: The antibodies were used as follows: SLC7A11 (ab37185, Abcam, Cambridge, UK), p21 Waf1/Cip1 (CST #2947, Cell Signaling Technology, Boston, Mass, USA), p27 Kip1 (CST #3686), CDK2 (CST #2546), CDK7 (CST #2916), Cyclin A2 (CST #4656), Cyclin B1 (CST #12231), Cyclin D3 (CST #2936), LC3 A/B (CST #12741), STX17 (YN4187, Immunoway, Plano, TX, USA), RAB33B (YN1177, Immunoway), UVRAG (CST #13115), Atg 7 (CST#8558), Atg16L1 (CST #8089), Akt (CST #4691), β-Tubulin (CST #2128), GAPDH (CST #5174), and anti-rabbit IgG, and an HRP-linked secondary antibody (CST #7074).

Techniques: Expressing

Journal: Frontiers in Oncology

Article Title: Low Expression of SLC7A11 Confers Drug Resistance and Worse Survival in Ovarian Cancer via Inhibition of Cell Autophagy as a Competing Endogenous RNA

doi: 10.3389/fonc.2021.744940

Figure Lengend Snippet: Effects of SLC7A11 and paclitaxel on the expression of related proteins analyzed by western blotting. The H-R-eGFP and H-R-SLC7A11 cells were treated with gradient concentration of paclitaxel for 72 hours. (A) Proteins were extracted and detected by western blotting to analyze the expression of p21 Waf1/Cip1, p27 Kip1, CDK2, CDK7, Cyclin A2, Cyclin B1 and Cyclin D3; (B) Expression of LC3 -II, LC3 -I, STX17, RAB33B, UVRAG, Atg7, Atg16L1 and Akt proteins were analyzed by western blotting. Representative blots were shown with GAPDH and β-Tubulin as loading control.

Article Snippet: The antibodies were used as follows: SLC7A11 (ab37185, Abcam, Cambridge, UK), p21 Waf1/Cip1 (CST #2947, Cell Signaling Technology, Boston, Mass, USA), p27 Kip1 (CST #3686), CDK2 (CST #2546), CDK7 (CST #2916), Cyclin A2 (CST #4656), Cyclin B1 (CST #12231), Cyclin D3 (CST #2936), LC3 A/B (CST #12741), STX17 (YN4187, Immunoway, Plano, TX, USA), RAB33B (YN1177, Immunoway), UVRAG (CST #13115), Atg 7 (CST#8558), Atg16L1 (CST #8089), Akt (CST #4691), β-Tubulin (CST #2128), GAPDH (CST #5174), and anti-rabbit IgG, and an HRP-linked secondary antibody (CST #7074).

Techniques: Expressing, Western Blot, Concentration Assay

Journal: Frontiers in Oncology

Article Title: Low Expression of SLC7A11 Confers Drug Resistance and Worse Survival in Ovarian Cancer via Inhibition of Cell Autophagy as a Competing Endogenous RNA

doi: 10.3389/fonc.2021.744940

Figure Lengend Snippet: SLC7A11 regulate 42 autophagy genes functioned as a ceRNA in 32 types tumors.

Article Snippet: The antibodies were used as follows: SLC7A11 (ab37185, Abcam, Cambridge, UK), p21 Waf1/Cip1 (CST #2947, Cell Signaling Technology, Boston, Mass, USA), p27 Kip1 (CST #3686), CDK2 (CST #2546), CDK7 (CST #2916), Cyclin A2 (CST #4656), Cyclin B1 (CST #12231), Cyclin D3 (CST #2936), LC3 A/B (CST #12741), STX17 (YN4187, Immunoway, Plano, TX, USA), RAB33B (YN1177, Immunoway), UVRAG (CST #13115), Atg 7 (CST#8558), Atg16L1 (CST #8089), Akt (CST #4691), β-Tubulin (CST #2128), GAPDH (CST #5174), and anti-rabbit IgG, and an HRP-linked secondary antibody (CST #7074).

Techniques:

Journal: Frontiers in Oncology

Article Title: Low Expression of SLC7A11 Confers Drug Resistance and Worse Survival in Ovarian Cancer via Inhibition of Cell Autophagy as a Competing Endogenous RNA

doi: 10.3389/fonc.2021.744940

Figure Lengend Snippet: SLC7A11 is positively correlated with the expression of STX17, UVRAG, and RAB33B in 90 drug resistant ovarian cancer tissues based on TCGA cohort. The correlation of genes was analyzed by bivariate correlation ( P < 0.05).

Article Snippet: The antibodies were used as follows: SLC7A11 (ab37185, Abcam, Cambridge, UK), p21 Waf1/Cip1 (CST #2947, Cell Signaling Technology, Boston, Mass, USA), p27 Kip1 (CST #3686), CDK2 (CST #2546), CDK7 (CST #2916), Cyclin A2 (CST #4656), Cyclin B1 (CST #12231), Cyclin D3 (CST #2936), LC3 A/B (CST #12741), STX17 (YN4187, Immunoway, Plano, TX, USA), RAB33B (YN1177, Immunoway), UVRAG (CST #13115), Atg 7 (CST#8558), Atg16L1 (CST #8089), Akt (CST #4691), β-Tubulin (CST #2128), GAPDH (CST #5174), and anti-rabbit IgG, and an HRP-linked secondary antibody (CST #7074).

Techniques: Expressing

Journal: Frontiers in Oncology

Article Title: Low Expression of SLC7A11 Confers Drug Resistance and Worse Survival in Ovarian Cancer via Inhibition of Cell Autophagy as a Competing Endogenous RNA

doi: 10.3389/fonc.2021.744940

Figure Lengend Snippet: As ceRNA targets of SLC7A11, (A) STX17, (B) UVRAG, and (C) RAB33B were positively co-expressed in 12, 20 and 12 kinds of cancers according to pan-cancer analyses. The other 2 cancers that SLC7A11 negatively co-expressed with RAB33B was excluded. The gene expression values from RNA-seq data were presented as log2 (FPKM + 0.01) ( P<0.05 ). BRCA, Breast Invasive Carcinoma; THCA, Thyroid Carcinoma; COAD, Colon Adenocarcinoma; PRAD, Prostate Adenocarcinoma; UCEC, Uterine Corpus Endometrial Carcinoma; READ, Rectum Adenocarcinoma; HNSC, Head and Neck Squamous Cell Carcinoma; LGG, Brain Lower Grade Glioma; ACC, Adrenocortical Carcinoma; UVM, Uveal Melanoma; KICH, Kidney Chromophobe; KIRC, Kidney Renal Clear Cell Carcinoma; SKCM, Skin Cutaneous Melanoma; LUSC, Lung Squamous Cell Carcinoma; TGCT, Testicular Germ Cell Tumors; BLCA, Bladder Urothelial Carcinoma; LUAD, Lung Adenocarcinoma; LAML, Acute Myeloid Leukemia; CESC, Cervical Squamous Cell Carcinoma and Endocervical Adenocarcinoma; KIRP, Kidney Renal Papillary Cell Carcinoma; UCS, Uterine Carcinosarcoma; THYM, Thymoma; LIHC, Liver Hepatocellular Carcinoma.

Article Snippet: The antibodies were used as follows: SLC7A11 (ab37185, Abcam, Cambridge, UK), p21 Waf1/Cip1 (CST #2947, Cell Signaling Technology, Boston, Mass, USA), p27 Kip1 (CST #3686), CDK2 (CST #2546), CDK7 (CST #2916), Cyclin A2 (CST #4656), Cyclin B1 (CST #12231), Cyclin D3 (CST #2936), LC3 A/B (CST #12741), STX17 (YN4187, Immunoway, Plano, TX, USA), RAB33B (YN1177, Immunoway), UVRAG (CST #13115), Atg 7 (CST#8558), Atg16L1 (CST #8089), Akt (CST #4691), β-Tubulin (CST #2128), GAPDH (CST #5174), and anti-rabbit IgG, and an HRP-linked secondary antibody (CST #7074).

Techniques: Expressing, RNA Sequencing Assay

Journal: Frontiers in Oncology

Article Title: Low Expression of SLC7A11 Confers Drug Resistance and Worse Survival in Ovarian Cancer via Inhibition of Cell Autophagy as a Competing Endogenous RNA

doi: 10.3389/fonc.2021.744940

Figure Lengend Snippet: ceRNA network of SLC7A11 with STX17, UVRAG and RAB33B. The ceRNA pairs were determined by StarBase and the network was constructed by Cytoscape. Acting as a ceRNA, SLC7A11 shared miRNAs with the target genes as indicated in the network. The light green oval indicate the miRNAs for SLC7A11 with RAB33B, the purple oval indicates the miRNAs for SLC7A11 with STX17, the rose-colored oval indicates the miRNAs for SLC7A11 with UVRAG, the green oval indicate the common miRNAs for SLC7A11 with RAB33B and STX17, the mauve oval indicates the common miRNAs for SLC7A11 with STX17 and UVRAG, the deep yellow oval indicates the common miRNAs for SLC7A11 with UVRAG and RAB33B, the sky-blue oval indicates the common miRNAs for SLC7A11 with STX17, UVRAG and RAB33B.

Article Snippet: The antibodies were used as follows: SLC7A11 (ab37185, Abcam, Cambridge, UK), p21 Waf1/Cip1 (CST #2947, Cell Signaling Technology, Boston, Mass, USA), p27 Kip1 (CST #3686), CDK2 (CST #2546), CDK7 (CST #2916), Cyclin A2 (CST #4656), Cyclin B1 (CST #12231), Cyclin D3 (CST #2936), LC3 A/B (CST #12741), STX17 (YN4187, Immunoway, Plano, TX, USA), RAB33B (YN1177, Immunoway), UVRAG (CST #13115), Atg 7 (CST#8558), Atg16L1 (CST #8089), Akt (CST #4691), β-Tubulin (CST #2128), GAPDH (CST #5174), and anti-rabbit IgG, and an HRP-linked secondary antibody (CST #7074).

Techniques: Construct

Journal: Frontiers in Oncology

Article Title: Low Expression of SLC7A11 Confers Drug Resistance and Worse Survival in Ovarian Cancer via Inhibition of Cell Autophagy as a Competing Endogenous RNA

doi: 10.3389/fonc.2021.744940

Figure Lengend Snippet: Effects of SLC7A11 and paclitaxel on the expression of related proteins analyzed by western blotting. The H-R-eGFP and H-R-SLC7A11 cells were treated with gradient concentration of paclitaxel for 72 hours. (A) Proteins were extracted and detected by western blotting to analyze the expression of p21 Waf1/Cip1, p27 Kip1, CDK2, CDK7, Cyclin A2, Cyclin B1 and Cyclin D3; (B) Expression of LC3 -II, LC3 -I, STX17, RAB33B, UVRAG, Atg7, Atg16L1 and Akt proteins were analyzed by western blotting. Representative blots were shown with GAPDH and β-Tubulin as loading control.

Article Snippet: The antibodies were used as follows: SLC7A11 (ab37185, Abcam, Cambridge, UK), p21 Waf1/Cip1 (CST #2947, Cell Signaling Technology, Boston, Mass, USA), p27 Kip1 (CST #3686), CDK2 (CST #2546), CDK7 (CST #2916), Cyclin A2 (CST #4656), Cyclin B1 (CST #12231), Cyclin D3 (CST #2936), LC3 A/B (CST #12741), STX17 (YN4187, Immunoway, Plano, TX, USA), RAB33B (YN1177, Immunoway), UVRAG (CST #13115), Atg 7 (CST#8558), Atg16L1 (CST #8089), Akt (CST #4691), β-Tubulin (CST #2128), GAPDH (CST #5174), and anti-rabbit IgG, and an HRP-linked secondary antibody (CST #7074).

Techniques: Expressing, Western Blot, Concentration Assay

Journal: Frontiers in Oncology

Article Title: Low Expression of SLC7A11 Confers Drug Resistance and Worse Survival in Ovarian Cancer via Inhibition of Cell Autophagy as a Competing Endogenous RNA

doi: 10.3389/fonc.2021.744940

Figure Lengend Snippet: SLC7A11 regulate 42 autophagy genes functioned as a ceRNA in 32 types tumors.

Article Snippet: The antibodies were used as follows: SLC7A11 (ab37185, Abcam, Cambridge, UK), p21 Waf1/Cip1 (CST #2947, Cell Signaling Technology, Boston, Mass, USA), p27 Kip1 (CST #3686), CDK2 (CST #2546), CDK7 (CST #2916), Cyclin A2 (CST #4656), Cyclin B1 (CST #12231), Cyclin D3 (CST #2936), LC3 A/B (CST #12741), STX17 (YN4187, Immunoway, Plano, TX, USA), RAB33B (YN1177, Immunoway), UVRAG (CST #13115), Atg 7 (CST#8558), Atg16L1 (CST #8089), Akt (CST #4691), β-Tubulin (CST #2128), GAPDH (CST #5174), and anti-rabbit IgG, and an HRP-linked secondary antibody (CST #7074).

Techniques:

Journal: Frontiers in Oncology

Article Title: Low Expression of SLC7A11 Confers Drug Resistance and Worse Survival in Ovarian Cancer via Inhibition of Cell Autophagy as a Competing Endogenous RNA

doi: 10.3389/fonc.2021.744940

Figure Lengend Snippet: SLC7A11 is positively correlated with the expression of STX17, UVRAG, and RAB33B in 90 drug resistant ovarian cancer tissues based on TCGA cohort. The correlation of genes was analyzed by bivariate correlation ( P < 0.05).

Article Snippet: The antibodies were used as follows: SLC7A11 (ab37185, Abcam, Cambridge, UK), p21 Waf1/Cip1 (CST #2947, Cell Signaling Technology, Boston, Mass, USA), p27 Kip1 (CST #3686), CDK2 (CST #2546), CDK7 (CST #2916), Cyclin A2 (CST #4656), Cyclin B1 (CST #12231), Cyclin D3 (CST #2936), LC3 A/B (CST #12741), STX17 (YN4187, Immunoway, Plano, TX, USA), RAB33B (YN1177, Immunoway), UVRAG (CST #13115), Atg 7 (CST#8558), Atg16L1 (CST #8089), Akt (CST #4691), β-Tubulin (CST #2128), GAPDH (CST #5174), and anti-rabbit IgG, and an HRP-linked secondary antibody (CST #7074).

Techniques: Expressing

Journal: Frontiers in Oncology

Article Title: Low Expression of SLC7A11 Confers Drug Resistance and Worse Survival in Ovarian Cancer via Inhibition of Cell Autophagy as a Competing Endogenous RNA

doi: 10.3389/fonc.2021.744940

Figure Lengend Snippet: As ceRNA targets of SLC7A11, (A) STX17, (B) UVRAG, and (C) RAB33B were positively co-expressed in 12, 20 and 12 kinds of cancers according to pan-cancer analyses. The other 2 cancers that SLC7A11 negatively co-expressed with RAB33B was excluded. The gene expression values from RNA-seq data were presented as log2 (FPKM + 0.01) ( P<0.05 ). BRCA, Breast Invasive Carcinoma; THCA, Thyroid Carcinoma; COAD, Colon Adenocarcinoma; PRAD, Prostate Adenocarcinoma; UCEC, Uterine Corpus Endometrial Carcinoma; READ, Rectum Adenocarcinoma; HNSC, Head and Neck Squamous Cell Carcinoma; LGG, Brain Lower Grade Glioma; ACC, Adrenocortical Carcinoma; UVM, Uveal Melanoma; KICH, Kidney Chromophobe; KIRC, Kidney Renal Clear Cell Carcinoma; SKCM, Skin Cutaneous Melanoma; LUSC, Lung Squamous Cell Carcinoma; TGCT, Testicular Germ Cell Tumors; BLCA, Bladder Urothelial Carcinoma; LUAD, Lung Adenocarcinoma; LAML, Acute Myeloid Leukemia; CESC, Cervical Squamous Cell Carcinoma and Endocervical Adenocarcinoma; KIRP, Kidney Renal Papillary Cell Carcinoma; UCS, Uterine Carcinosarcoma; THYM, Thymoma; LIHC, Liver Hepatocellular Carcinoma.

Article Snippet: The antibodies were used as follows: SLC7A11 (ab37185, Abcam, Cambridge, UK), p21 Waf1/Cip1 (CST #2947, Cell Signaling Technology, Boston, Mass, USA), p27 Kip1 (CST #3686), CDK2 (CST #2546), CDK7 (CST #2916), Cyclin A2 (CST #4656), Cyclin B1 (CST #12231), Cyclin D3 (CST #2936), LC3 A/B (CST #12741), STX17 (YN4187, Immunoway, Plano, TX, USA), RAB33B (YN1177, Immunoway), UVRAG (CST #13115), Atg 7 (CST#8558), Atg16L1 (CST #8089), Akt (CST #4691), β-Tubulin (CST #2128), GAPDH (CST #5174), and anti-rabbit IgG, and an HRP-linked secondary antibody (CST #7074).

Techniques: Expressing, RNA Sequencing Assay

Journal: Frontiers in Oncology

Article Title: Low Expression of SLC7A11 Confers Drug Resistance and Worse Survival in Ovarian Cancer via Inhibition of Cell Autophagy as a Competing Endogenous RNA

doi: 10.3389/fonc.2021.744940

Figure Lengend Snippet: ceRNA network of SLC7A11 with STX17, UVRAG and RAB33B. The ceRNA pairs were determined by StarBase and the network was constructed by Cytoscape. Acting as a ceRNA, SLC7A11 shared miRNAs with the target genes as indicated in the network. The light green oval indicate the miRNAs for SLC7A11 with RAB33B, the purple oval indicates the miRNAs for SLC7A11 with STX17, the rose-colored oval indicates the miRNAs for SLC7A11 with UVRAG, the green oval indicate the common miRNAs for SLC7A11 with RAB33B and STX17, the mauve oval indicates the common miRNAs for SLC7A11 with STX17 and UVRAG, the deep yellow oval indicates the common miRNAs for SLC7A11 with UVRAG and RAB33B, the sky-blue oval indicates the common miRNAs for SLC7A11 with STX17, UVRAG and RAB33B.

Article Snippet: The antibodies were used as follows: SLC7A11 (ab37185, Abcam, Cambridge, UK), p21 Waf1/Cip1 (CST #2947, Cell Signaling Technology, Boston, Mass, USA), p27 Kip1 (CST #3686), CDK2 (CST #2546), CDK7 (CST #2916), Cyclin A2 (CST #4656), Cyclin B1 (CST #12231), Cyclin D3 (CST #2936), LC3 A/B (CST #12741), STX17 (YN4187, Immunoway, Plano, TX, USA), RAB33B (YN1177, Immunoway), UVRAG (CST #13115), Atg 7 (CST#8558), Atg16L1 (CST #8089), Akt (CST #4691), β-Tubulin (CST #2128), GAPDH (CST #5174), and anti-rabbit IgG, and an HRP-linked secondary antibody (CST #7074).

Techniques: Construct